You have no items in your shopping cart.
CD69 protein [Out of Stock]
SKU: orb763261
Description
Research Area
Epigenetics
Images & Validation
−![CD69 protein [Out of Stock]](/images/quality_badge_proteins.png)
| Application Notes |
|---|
Key Properties
−| Expression System | E.coli |
|---|---|
| Tag | His-tag |
| Molecular Weight | ~17kDa |
| Expression Region | pet-22b(+) |
| Protein Sequence | AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA |
| Purification | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
Storage & Handling
−| Storage | Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles. |
|---|---|
| Buffer/Preservatives | PBS, 4M Urea, pH 7.4 |
| Concentration | > 0.5mg/ml |
| Disclaimer | For research use only |

Quality Guarantee
Explore bioreagents carefree to elevate your research. All our products are rigorously tested for performance. If a product does not perform as described on its datasheet, our scientific support team will provide expert troubleshooting, a prompt replacement, or a refund. For full details, please see our Terms & Conditions and Buying Guide. Contact us at [email protected].
Quick Database Links
UniProt
UniProt Details
− No UniProt data available
Documents Download
Datasheet
Product Information
Request a Document
Protocol Information
CD69 protein [Out of Stock] (orb763261)
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review